Obligatory disclaimer: on mobile, non English speaker (due to a previous post, I thought I write everything in my language and pass through Google translation and the post it, but I may lose my reservation in Hell)
Still on hubby's account, an autocorrect error (and my son's hungry stomach) reminded me of my first conscious MC. It also kept away from Mexican food until I remet my husband.
Back in the begin of the 21th century, I was working in a cafe/sandwich shop. It was a 24/7 shop in a prime location (in an area with a lot of uni students and very active nightlife and the road was a major artery for anyone traveling in or out of the city). When I started, as a first year uni student trying to make some money, the shop was one of four of a small chain. Gary, the ownemanager has bought the rights from the original shop. Gary was also doing Quality Control for the shop, because at that point every shop had separate vendors.
Fast forward two years. The original owners decide to incorporate, because they have a lot of offers for franchising and a couple of problems with Quality Control have appeared. So, they bought back all the shops and instituted a more centralized approach to vendors. That was good for Gary, because he was the owner of the building, so he basically became a salaried manager and got extra income from the rent. Initially, nothing changed. We were still number 2 in sales, product was good. Then Dick entered the picture.
Dick was the new regional manager (the small chain had became big enough to reach national level) and the person responsible for Quality Control. He was considered something of a golden boy, having a business degree and helping with the expansion. The problem came from his ego. You see, Dick had done a cooking workshop (that provides a certificate, but nothing more) and considered himself something of a chef.
His first major change was installing a crepe station. Not restaurant quality crepes, but crepes on the go (folded like a triangle). That is important for later. While a bitch to learn at the beginning, it quickly became on of our best sellers. We usually went over 10L of crepe mixture on a slow day. Having success with his first change, Dick decided to apply his "chef" training and implement some new things.
At that point in time, Mexican cuisine was becoming popular in my country, due mostly to cooking shows. Dick decides to ride the trend and starts putting "Mexican" options on the menu. In reality, that meant two more "set" sandwiches and crepes (the ones on the board) and a few more customization options for sandwiches and crepes. And here begins the problem.
As I said, Mexican cuisine was quite the new thing. Our country's cuisine is wayyyy different than the Mexican, especially on the spice level. A lot of the produce used for Mexican food was either rare or nonexistent. But Dick was adamant it was another win for him found a vendor. And the quality started to fail.
We started to receive buckets of premade chili and queso and jars of picked "jalapenos" and premade guacamole and pico de gallo dips. Also, blocks of white cheese labeled "queso blanco". The "queso" was an orange paste with some red bits in it (according to hubby, under a bad light it could pass for bad queso) and the left a very plastic taste (it reminded of clay). One taste of that kept me away from Mexican food for a while. The "jalapenos" weren't jalapenos. They were pickled Thai Green chilies, labeled as "jalapenos", meaning they were way hotter than expected. I've never tasted the rest, but some adventurous customers that tried them, weren't impressed. The only new thing that kind of sold was a plate of nachos. Basically because it was Doritos covered in queso (when it was heated, it became an orange liquid), a lot of bacon and a lot of sausage. We have complained about the quality to Gary, but he couldn't do anything anymore and Dick doesn't backs down.
Dick is a bit upset from the low sales. He blames us ("you're not pushing them enough") and the customers ("those barbarians couldn't recognize a fillet mignon from a shank"), but he sticks to his guns. And then brings corporate to the shop.
Dick comes in with four people from HQ, two of them are the owners. They sit and Dick comes and place an order of five "quesadillas" (it's a self service shop). I ask how he wants them.
"Exactly as it says on the board and prepared exactly as I told you" he replies.
"Ok sir. I will call you when they're ready" I replied smiling.
Now Dick, in all his "chefy" wisdom, has given us very specific instructions for the "quesadillas". First, to take out of the way, it wasn't a proper quesadilla, it was a crepe. The instructions were: "reheat the chili, start the crepe, place one and a half ladles of reheated queso, add one ladle of the chili, add a tablespoon of chopped jalapenos, one tablespoon of queso blanco, half a tablespoon of guacamole and fold". Doing that, produced a liquid mess, which tried really hard to escape from a thin crepe. We usually reheated the queso only for nachos. Especially in a crepe, we put it cold and let it reheat with the plate's heat to avoid the aforementioned mess.
Cue malicious compliance:
We (me and the other girl working) make 5 "quesadillas" exactly as instructed. I took the order to the table (it was corporate after all) and waited for the results.
Five people, wearing white shirts and suits, bite into the "quesadillas". The "quesadillas" almost simultaneously explode, raining melted cheese and red chili on them. Some of them have bitten a "jalapeno" and the heat is hitting then hard. A few choice words were heard. We brought them two bottles of water for the heat and two full packs of napkins to clean what they could. Let's say the new menu wasn't a blast with HQ.
After they left, Dick came back. He was beyond angry. He approached the bench, bypassing the line (it was during one of our rush hours) and made a scene.
The following dialogue is a bit censored:
"You stupid bitch! You made me look bad because you don't like Mexican food! You can't even follow basic instructions! The cleaning of your mess will be deducted from your pay!" and some other more offensive stuff.
I was standing there dumbfounded, along with a long line of customers hearing his outburst. And then Gary intervened.
"Shut the fuck up!"
"What the fuck did you say?" Dick replied.
"I said SHUT THE FUCK UP! The girls followed your instructions to the letter. Don't try to blame them for your mistake. Or make them pay for your dry cleaning."
Dick: "I can do what the fuck I want. And when I'm finished with them, maybe I'll find another manager for this shop."
Gary: " I would love to see you try.
Dick: "Oh, I will! I will!" and he stormed out.
Fallout:
Immediately Gary called HQ and notified about what happened. He also gave an ultimatum. If something happened to his staff, the company would need to find a new location.
Three days later, we were notified that Dick was fired. While his outburst was the main reason, one of the owners having a really bad reaction to the "jalapenos". A week later, the Mexican menu was removed. During that part, they found out that Dick had used the cheapest vendor for the new menu. The vendor had a reputation for shady practices, which partly explained the weird products.
I stayed there until I finished uni and got a job in my field. The Mexican menu made a huge comeback two years before I left. This time, HQ had hired a proper Chef to consult and find vendors. Now the ingredients are as authentic as possible and pico and guac are made daily in house. They also have good queso now, although it took me a long time to try it. And no prepackaged, premade chili. In fact, no chili at all. My repulsion to Mexican food ended when my husband took me to a proper Mexican restaurant and finally tested a proper Mexican meal.
Edit: Well, this escalated quickly... Thank you all for the awards and you a anonymous redditor for the gold. I've been in the comments and need to address to things. 1) I didn't put it through Google Translate. 2) When I say chili, I mean chili con carne. Although, with some of the knowledge I have now I would characterize is as "a bad Sloppy Joe meat mix with delusions of grandeur".

The Daily Check-In for Tuesday, February 2nd: Just for today, I am NOT drinking!

Cut my salary in half? Kiss your business goodbye.

The cast: (Names changed for anonymity)
Me - your storyteller of the moment.
Chad - Hiring CTO.
Richard - CEO, brother of Chad.
Big Bro - Engineer coworker
Eddie - IT and Desktop support guy.
This takes place near the very beginning of my software engineering career, back in '05 or '06. I'd just been let go from my previous place of employment due to be being compliant with directives I'd been given (although not maliciously, so that story wouldn't be appropriate here, sadly), and thus working myself out of a job. I was a young college dropout from a technical college that hadn't been federally accredited yet, and thus all my student loans were from banks and loan companies instead of from Uncle Sam, and debts were due. I was also making payments on my very first car, even though it was a beater that the prior owners had already nearly driven into the ground (4 years old and nearly 200k miles on it when I bought it), and of course, rent and utitlities. The job I'd just been let go from already had me working paycheck to paycheck as they paid far under average rate, but I was still new professional so I couldn't be very choosy. I was living in Los Angeles county, so the cost of living was so bad, I was having to choose which bills were going to be late on a monthly basis. Specifically, I was living in a town called San Pedro, a small town tucked fairly out of the way.
After blasting my resume to all the job boards, I get a call from a startup who seems interested in my resume and wants me to come in for a face-to-face interview (skipping the call-screen entirely). In my desperation, I agree. I'm given an address, which is all the way up in Woodland Hills. I check the internet... 55 minute drive so long as there's no traffic. With traffic it looks like the commute will be more like an hour and forty-five minutes... each way. I'm desperate though, and literally nobody else has reached out to me about my resume or responded to my applications, so I go to the interview. I arrive to an mostly empty office complex. Maybe 6 or 7 other cars in a parking lot capable of holding at least 50. I go into the building mentioned in the address, and call the phone number I was given to let them know I've arrived. Enter Chad. Chad comes to meet me, and seems excited that I've come! He escorts me through the building to an office. Mind you, as far as I can see, we're the only two humans in the building. He gives me the pitch for the company, tells me he built the software being sold, but it's not scalable, and needs someone who can rewrite it. After we go through the whole interview song and dance, he offers me the job on the spot. The pay is marginally higher than the last gig, so I figure gas would be covered for the commute. I agree, and we shake hands, as I'm going to be starting the next Monday.
Red flags start appearing from the very first minute I arrive on monday. First, I'm given a tour, which consists of the 14x14 foot office I'm going to be sharing with Chad, as well as another engineer who's going to be starting the following monday. I'm not a fan of having someone able to look over my shoulder, it makes me nervous. I ask why each engineer's desk has two computers. "Because the one you will be writing code on doesn't have internet access, for security purposes." (Note: this was pure paranoia. There was nothing about this software that required such tight security, we weren't doing any gov't contracts or anything of the sort.) Then, I'm escorted clear across the building, to meet with the CEO (Richard), the IT guy (Eddie), and the sales/support team. I'm told that half of the team is supporting the existing version of the application, 2 people are selling the existing version to new clients (or trying to), and one person is explicitly tasked with selling the new version. The one I haven't even started on yet. I'm still young and dumb at this point, but even I know this means the salesperson is probably giving out a date when the customer should expect their purchase to be filled. "It's a good thing you started when we did, we've been telling customers it'll be ready in June." Did I mention all this was happening in February? Apparently I've agreed to rewrite, test, and package an entire application I've never seen before in approximately four months. So, tour being done, I sit down and get to work. After jumping through a bunch of hoops of getting the software I prefer downloaded onto the actual work machine, as well as the code, I set about reviewing code so horrific I've not seen its like since, and there isn't a single comment in the entire thing. Before I can ask a single question of the CTO however, he tells me he's headed to downtown LA to scalp his tickets to the Lakers game, and that he'll see me tomorrow. So... now I'm alone in the office with this abomination, a machine that's been hamstrung to heck and back, and the only thing I've got to console me is the fact that at least I'm employed again.
Fast-forward a week, I've documented the bulk of the code (because there wasn't any), and the boss and I do not get along. He's mad because I've not written any substantial code, and I'm frustrated because I'm trying to understand a lot of what specific code is trying to do and he's routinely leaving around noon to go sell his tickets for Laker's games, or just not in the office because he's chatting with someone else. When he is in the office, I show him my documentation, and try to get him to verify it or describe the purpose of code where all I can say is "Wat?" By the end of the week, I've covered about 30% of the project in a wiki-like document, and I've taken to leaving after sunset so I can a) get more done, b) have a shorter commute, and c) drive when my car isn't an oven (the ac didn't work). I've barely managed to convince the CTO that what I'm doing is necessary so the engineer starting the next monday doesn't have to do anywhere near the same crap I've got, which would make us a more efficient team.
Monday arrives, and in comes Big Bro. I call him this because he was a much more experienced engineer than I was. We spend the first day with him getting set up, then us reviewing what I've documented. He manages to answer some questions the CTO never did, just because he is that much better, and I start to feel more confident. Over the next weeks, Big Bro took me under his wing as an engineer teaching me best practices, standards, and where my plans were good and where they could be better. If it hadn't been for him, I'd have gone insane! I end up joining him outside for smoke breaks even though I don't smoke, just so I can get a breath of non-office air. He and I discuss the project, and we also make friends with Eddie, who makes us laugh by telling us horror stories about the CTO and CEO (apparently he was a school *friend* of theirs and basically worked with them because they paid him to do something he felt was super easy).
April rolls around. I've got a special occasion I need the day off for, which happens to be a Wednesday that year. I'd advised him when I first started and he'd been cool with it. I remind him on April 2nd (since I had an irrational fear of policy decisions being made on April Fool's Day), and he loses it. He goes off on a rant, and straight up informs me that he regrets hiring me, claiming I didn't have the skills I told him I did, and wasn't worth what I was being paid. We're definitely not half-way done (more like one third), and it's already been decided that June is a lost cause and that we're shooting for August now. That habit I started before, of leaving after the sun went down? Yeah, that never stopped. I was arriving at 9am every day, and leaving around 10pm every night, trying my best. Big bro was the same, and Eddie would stay late with us just because we liked hanging out together. So, it should be understandable that I was very close to losing it right back at him. In a strained, yet diplomatic voice, I told him that if he put in the same amount of work to help us as we put in to rewrite *his* code, we'd probably be a lot closer to done than we were, especially given the twelve hour days. He was not a fan of that, and switched to straight up yelling, blaming us for the lost sales and refunds due to the delays, and that the only way he'd get off our backs was by getting the project done. This entire time Big Bro is just sitting there, and says nothing to back me up. Chad then left the office for a bit, and I just declared I was taking my lunch and would be back in an hour. I felt frustrated by Chad and betrayed by Big Bro, who I felt (rightly or not) should have had my back since we were in the same boat.
When we were both back in the office, he apologized for yelling and told me that since he agreed when I was hired I could have my day off. Cool. I apologized too, although not for anything specific. I just didn't want to talk to him anymore and figured that was the fastest way to end the conversation.
Fast forward to June, and the opportunity for Malicious Compliance. Over the last two months, Chad has been getting worse and worse. He's yelling nearly every day (and still leaving early too). Big Bro and Eddie are also feeling the pain, nobody is safe from his ego. The smoke breaks and afternoon/evening portion of our day are when we're most productive, as nobody can focus until Chad leaves. The first monday in June rolls around and Chad invites me to go on a walk outside for a 1-on-1 meeting. I figured I'm being fired (at this point we've had to refactor the rewrite almost entirely due to missing a critical chunk of functionality, and we're still only 60% done. August release is looking less and less sure). Chad informs me that he's hired a 3rd engineer, but in order to stay in the budget to pay him, he's cutting my salary in half. I stop on the spot and just give him a blank look.
"Are you serious?" I ask. "I'm barely able to pay for my bills and the gas required to commute here as it is. If you cut my salary at all, I won't be able to afford to live." At this point the idea of cutting my productivity to help ramp up a new engineer so he can help us meet the deadline doesn't even occur to me, although in hindsight that would have also been a pretty major issue.
Chad brushes me off. "That's not my problem. The fact that you missed one deadline and look like you're gonna miss another is. If you've got a problem with that, you're more than welcome to go find another job. The new guy starts in two weeks." And with that he walks inside. I'd just been told that I had two weeks left of job at my current salary. Cool. So that day I do something I hadn't done since I first started. I left while the sun was still up. (Specifically, I left at 5pm). I drive my oven-car (no working Air Conditioning in a car that had been left in the sun all day in Woodland Hills had me feeling like a baked potato) through traffic (hour and a half-commute home through LA heat), and updated my resume before reactivating my accounts on all the job sites. I'm contacted the next day by a potential new employer, and I get an interview scheduled. I decide to tell Big Bro about the new opportunity, and he hits me with news that lets me know just how small a world we live in.
Me: "Hey, Big Bro, just fyi I've started looking for a new job. I've already got an interview lined up."
Big Bro: "Really? Where?"
Me: "Over at "
Big Bro: "Wow! That's where I worked before I came here! That place is pretty awesome, and I left there on pretty good terms. I know the CTO there, go ahead and use me as a reference!"
Me, skeptical: "Really? Okay...."
Turns out Big Bro was true to his word, and the CTO and I even talked about Big Bro during the interview. Apparently they'd already talked about me, and Big Bro had been the ultimate hype man, confirming everything I said about why I was looking for a new job and everything. All goes well, and I'm electronically signing an offer-letter that Friday afternoon (Chad had already left for the day, so there was nobody to look over my shoulder as I used the work computer that *had* internet access to get this done). At the new Job, the commute is cut by more than half, and comes with a pretty significant raise. I tell Big Bro and Eddie on the last smoke break (I still don't smoke) that I'm done, and I've found something new. Oddly enough, they both smile and just wish me luck. "No hard feelings, hope we stay in touch!" Odd, but I'd stopped really caring about anything related to that job, so I paid it no mind. I went back inside, packed up my stuff into my backpack, and walked to the CEO's office.
Me: "Hey Richard, got a minute?"
Richard: "Hey OP, what's up?"
Me: "Just wanted to let you know I found a new job, so I'm moving on."
Richard: "Really, why? We need you!"
Me: "You guys decided it was cool to cut my salary to a point where I couldn't afford to live. Chad said if I didn't like it, I should look for something new, so I did."
Richard, looking defeated: "Well, when's your last day?"
Me: "Today."
Richard, now pissed: "We need you here to train the new guy who starts soon!"
Me: "Hey, I had to train myself and to an extent, Big Bro when he first started. The new guy should be able to as well."
And with that, I left for greener pastures.
The unexpectedly *huge* fallout:
Four months later, Big Bro texts me to ask me how things are going. I tell him things are great, and we schedule a lunchtime call because apparently things have gone sideways in a huge way.
Part 1) Apparently Chad came in on Monday almost violently angry, and demands Eddie re-image my work machine first thing in the morning, which erases everything I'd left on there.Big Bro comes in an hour later, and he and Chad discuss the new timeline for the project. Somewhere in there apparently Big Bro asks Chad to log into the admin account on my old work machine so he can pull the documents I'd accumulated about the planned architecture, the existing code, meeting notes, etc. Chad answers by apparently punching a hole in the wall, and leaving for the day (probably to go to the hospital to deal with his hand), at 10:30 in the morning. Big Bro then spends the rest of that week ostensibly working on recreating the documentation from scratch.
Part 2) When I asked how the new guy handled the new documentation, Big Bro laughed and told me there never was any documentation. Apparently he and Eddie had become really good friends in the months we worked there, to the point where they'd become roommates about a month before I left. More than that though, they'd decided to start a freelance/consulting business together and only had to decide on when to make that their full time jobs. Neither of them liked Chad much, and wanted to make their departure hurt as much as possible. So, they decide to make Big Bro's last day the day before the new guy starts, and Eddie would quit shortly afterward, sticking around just long enough to watch the bomb go off. Did I mention Big Bro never told Chad he was quitting? Yeah. He just didn't show up that Monday. He had, however, emailed that 'documentation' he'd spent a week writing to Chad. Turns out he wasn't documenting the code at all. He'd spent a week writing a letter explaining in excruciating detail why Chad was such a bad boss, and he'd emailed it to everyone in the company. I asked if he still had it so I could read it, and he sent it to me after the call.
Thankfully, like the big helper he was, Eddie had ensured that the new guy's email was set up and in the proper groups before the email was sent, so the guys first email in the company was a novella about the kind of person he' agreed to work for. Apparently Chad thought it was appropriate to take his frustration out on the new guy, who'd already read a significant portion of the email before Chad shoved him away from his desk and deleted it. Apparently new guy promptly decided (and rightfully so) that agreeing to work for Chad had been a mistake, packed up his things, and quit on the spot.
Part 3) With the new guy quitting, the August deadline was now little more than a dream within a dream, which according to Eddie doesn't stop Chad and Richard from trying to find that miracle rock star engineer who can save them from their own situation (which, given what they were offering as pay, didn't exist). So time advances in its unstoppable way, August arrives, and customers find that they've paid for something that hasn't been delivered yet, and pretty much unanimously demand refunds, with a few customers bringing legal action against them. With the amount they have to refund, and the money they now need for legal fees (because of they way they'd incorporated, they were personally liable), they could no longer afford to pay anyone, and were forced to shutter the business.
_________________
Final Note: For my fellow software engineers out there who were wondering just how bad this application was, this "program" was a single php file with over 40k lines of code, running inside a `while` loop. Any and all logic consisted of if/else trees, which then led to either more if/else trees or more loops. No function calls, no external libraries included, just.... spaghetti of the worst kind. Given the nature of the application, most critical logic had to be implemented in no less than seven places, depending on where the execution was when the logic was needed. At worst the tab-depth was something like nineteen or twenty tabs deep.
_________________
Post upvote-splosion edit:
I wanted to write out my thanks, and to answer some of your questions, but it turned into another long wall of text. So, instead I put it in a comment, which I'll link to here:
https://www.reddit.com/MaliciousCompliance/comments/lb8evx/cut_my_salary_in_half_kiss_your_business_goodbye/glvy3kg/

The next BTC crash could be something to behold

Also on my blog with better formatting, cute footnotes and inlined images.
Note that not much here is new material, mostly rehashing existing points.

Disclaimer

This article started out as research for my betting against Bitcoin on the stock market. This isn't financial advice. As a matter of fact, I encourage all readers you to not buy or short crypto, through any market or derivative. Use your money for productive uses.
Here's a TL;DR:

The current parabolic price increase in Bitcoin is a bubble that has started popping.
A stablecoin called Tether is either one of the largest frauds or money laundering operation in history, and is providing most of the liquidity in the cryptocurrency ecosystem.
A BTC bubble pop, incoming regulation on stablecoins or the current NYAG investigation into tether will expose tether's insolvency to the crypto market. This is bigger than it sounds.
(Speculative, but one can hope) Current prices to mine BTC could end up higher than BTC market price, exposing BTC to a 51% attack.

A Recap: Bitcoin is useless and should go away

Bitcoin serves no purpose. Let's just rehash that by quickly debunking the major claimed uses over time as seen here

Proof of concept: No argument here, but now that the market cap of cryptocurrencies is closing in on a $700B, this seems moot.
Cheap Payment Network: Nonsense, since BTC transactions are currently >$10 and this worsens the more people use it.
Anonymous Darknet Currency: I'd have said "no argument here", but apparently it's surprisingly easy to trace BTC nowadays. However, crypto ecosystem as a whole seems to do a decent job at laundering money as we'll see later.
Reserve Currency for Crypto: Since a reserve currency should be useful as a means of exchange, and I wrote several thousand words on how BTC is not that, my position is pretty clear. Also, the fact that a cryptocurrency indexed to the US dollar has trounced BTC as the main means of exchange in the crypto ecosystem speaks for itself.
Programmable Shared Database: You know what's programmable, shared and a database? The database we use at work. Just learn to implement access control lists on your SQL server.
Uncorrelated Financial Asset: Given BTC crashed just like the rest of the market when COVID showed up, this doesn't hold up

The stupidest version of the "uncorrelated asset" argument I hear is "Bitcoin is a great hedge for inflation!"
You know what's a good "hedge for inflation"? Literally anything. The definition of inflation is "the price of money". If the price of money goes down (inflation) then everything else has a positive return by comparison.
People who say "bitcoin is a good hedge for inflation" shouldn't be trusted to manage their own money, let alone give financial advice to anyone.

Censorship Resistant e-Gold: This is a roundabout way of saying "BTC is a store of value"! Which, again, can only be said by people who've never read the definition of "store of value" in a textbook.

I already went into detail into this, but BTC is a terrible store of value because it's volatile. Assets that can lose 20% of value overnight don't "store value". BTC is a "vehicle for speculation".
The only way price is sustained for BTC is that you can find some other idiot to sell it to. Just as a reminder, 50% of Gold is used for things that aren't speculation, like Jewelry, so you'll never have to worry finding a seller there.
Here are some real uses for bitcoin:

Gambling is fun. You buy BTC, the price might go up! Or down! This is exciting.
Hackers, money launderers and other criminals certainly find cryptocurrencies useful.

Reminder: BTC is an ecological scourge
The current cost to mine a BTC is around $8000 in electricity. This electricity mostly comes from subsidized coal in China.
And given the current amount of BTC generated each day, we're using about equivalent to the electricity from all of Belgium, largely in coal, to keep this going.
I don't mind wasting time on intellectual curiosities, but destroying our planet for glorified gambling is not something I'm happy about. I want cryptocurrencies to go away entirely on this basis, philosophically.

Current BTC prices are a bubble

Before we go into tether, reminder that at the time of writing, the plot of BTC price against the S&P500 looks like this
BTC price has increased by ~800% since March. Still, no one uses it for anything useful since the last bubble in 2017, or the other one before that in 2013. This is another bubble however you put it.
BTC is not "new technology"
10 years the internet became popular, Google and Amazon already existed. We're 8 years after the popular emergence of deep learning and it has already revolutionized machine translation, computer vision and natural language processing in general.
You could argue that deep learning and the internet existed before their emergence, but so did cryptocurrencies. Look up b-money and hashcash for instance.
Bitcoin has existed since 2008 and emerged in popularity around the same time as deep learning did, yet we're still to find actual uses for it except speculation and criminal uses. It's a solution waiting for a problem.
Institutional investors are also idiots
The narrative this time is that "institutional investors" are buying into BTC. This doesn't mean it's not a bubble.
Many of the institutions were buying through Grayscale Bitcoin Trust. Rather, many of them were chasing the premium over net asset value that hovered around 20%. Basically, lock money in GBTC for 6 months, cash out and collect the premium as profit. Of course, this little Ponzi couldn't last forever and the premium seems to be evaporating now.
Similarly, totally-not-a-bitcoin-ETF-wearing-a-software-company-skinsuit Microstrategy (MSTR) trades at a massive premium over fundamentals.
There will always be traders chasing bonuses from numbers going up, regardless what is making the number going up. The same "institutional investors" were buying obviously terrible CDOs in the run-up to 2008.

Tether is lunacy

Tether is a cryptocurrency whose exchange rate is supposed to be pegged to the US Dollar. Initially this was done by having 1-to-1 US Dollar reserves for each tether issued. Then they got scammed by their money launderer, losing some $800M, which made them insolvent.
Anyway, now tether maintains their reserves are whatever they want them to be and they haven't gotten audited since 2017.
You know, normal stuff.
There's a problem to backing your USD-pegged security with something that isn't US Dollars. Namely, if the price of the thing you're backing your US Dollars against goes down, you're now insolvent. If you were backing $10B in tether with $10B of bitcoin, then the bitcoin drops by half, you're insolvent by $5B.
And then this spotlessly clean company they somehow added $20B to their balance sheet in the second half of 2020
Reminder: one side of that balance sheet is currently floating around the cryptocurrency ecosystem. Cryptocurrency traders own it as an asset and sell it to others. The other half of the balance sheet is whatever tether wants.
There are only two possibilities that explain tether's growth:

Massive unbacked issuances, because they're afraid their scam has run its course.
Money laundering. Lots of it.

It could also be a happy mix of both.
One particularly interesting date is 30/8/2020, where tether added $3B to its balance sheet overnight. This is interesting because it predates the subsequent movement in bitcoin price and large movements in other cryptocurrencies.
The story from tether and tether's bank's CEO is that this money largely comes from foreign nationals through an OTC desk which implies the transaction goes as following:

A foreign national sends money in a foreign currency to an OTC desk. This is exactly as clean as you'd think -- often raw cash transactions in the millions.
That OTC desk converts the money to USD and sends it to tether's correspondent US bank. The OTC desk gives tether to the foreign national.
Wait tether has a correspondent US bank?

Oh, I forgot to mention, no bank wants tether as a customer because they obviously break KYC/AML compliance. So tether first ~~bought~~ invested in a bank called Noble which then lost its relationship with Wells-Fargo when they realized tether were lying to them about AML. Poor tether lost its legal access to USD.
Tether has been banking in the Bahamas with a bank called Deltec since. First they had a money launderer called Crypto Capital Corp to send funds to customers, who stole the $800M from them and subsequently went to jail.
But worry not! Tether found a way to get banked in USD afterwards. Curious coincidence, an executive at Deltec was randomly blogging about buying small US community banks in 2018. You know, that thing money launderers do.
So tether's story is that in 2020, they took in roughly twenty billion USD of shady foreign money into the small community US bank their deltec bankers bought. These transactions are necessarily breaking KYC/AML. The foreign parties to those transactions wouldn't take such a rickety route to convert billions into cryptocurrencies if they weren't laughed out of the room in serious banks.
But of course, Deltec will say it did KYC on tether. Really solid KYC, clearly, since they're the last bank on earth taking tether's business. Tether says they do KYC on their customers (the large OTC desks). And I'm sure the OTC desks would be shocked, shocked if the cash money they get in Russia and China turns out to be dirty. So everyone can pass the buck of responsibility down the road and claim "We do KYC on our customers".
Sure you do, tether. If you did such great KYC, you wouldn't have such problems finding banking relationships. I mean when even HSBC is not doing business with you you're apparently more obviously moving criminal money than fucking drug cartels.
And, according to tether's people, this money is what's backing tether's reserves. Money that will get frozen the instant a prosecutor even looks at it.
Reminder: the above is the charitable, positive case for tether.
The less charitable case is that they took crayons and added zeros to their balance sheet, and that there's a couple billions waiting to burn a hole in the crypto ecosystem.
Anyway, the $25B garbage fire that is tether will make a great book/netflix series at some point and their hilariously stupid CTO going on podcasts while flinching on questions about how BTC ended up on their balance sheet will be a fun part of it.
But I'm not here to write a book, I'm here to make money by shorting all of this. For my purposes, even in the positive case tether is a ticking time bomb waiting to burn a hole in the crypto ecosystem, because...

KYC and AML are coming for cryptocurrencies

If you listen to "crypto news", all incoming crypto regulation is just great, because that means crypto is becoming legit. However, companies investing in crypto are very angry about them.
This is because crypto transactions break the FinCEN travel rule, where KYC information should "travel" along transactions, to prevent money laundering obfuscation schemes.
Of course, according to the crypto industry this is "stifling innovation". A more reasonable take is that by being leaving the crypto industry outside normal financial regulations, we're enabling a "race to the bottom". As we saw with shadow banks in the 2000-2007 era this leads to "creative banking". I don't want my bankers to be creative, I want them to be solvent.

Tether's effect on the crypto ecosystem

When tether implodes, it's taking most of the crypto industry along for a fun ride. Tether can implode in one of a few ways:

A BTC price crash triggers it. If
Regulators decide they've had enough of AML avoidance and regulate them.
The NYAG investigation, which is waiting for an update in a few weeks, finds something and shuts them out.

Let's assume tether falls to $0 for simplicity. The analysis is the same directionally if tether significantly "breaks the buck".
This doesn't happen instantly, but it happens quickly. The peg breaks, and most people holding tether will try to sell it for other crypto (BTC, ETH, etc.). This puts downward pressure on the price of tether, incentivizing even more people to "pass the buck". Automated inter-exchange arbitrage bots might try to exploit emerging gaps in bid-ask spreads, only to end up with worthless tether instead, as their operators rush to pull the plug.
Then, we have a small village of cryptocurrency enthusiasts being out some $24B. With the trading bots turned off and the trading lubricant (a dollar pegged asset) gone, the bid-ask spreads blow up. You get a predictable flight to safety -- that is, to real money. This puts downward pressure on BTC.
While all of this is happening, there are all sorts of fun second-order effects happen. A lot of DeFi derivative products are priced in cryptocurrencies, so having normally stable prices shuffle around (eg. USDC price moving above $1 in a flight to safety) triggers a tsunami of margin calls. Some exchanges might insolvent (they're the ones redeeming tether for USD after all).

If BTC price drops below $8000, fun things happen

Currently, the price to mine a BTC is roughly $8000. Most of the mining comes from huge mining farms using subsidized coal in China, and mining costs more the more hardware there is to mine it.
Since the price of BTC hasn't substantially dropped below cost to mine we're in for a fun experiment if the price drops below this threshold. Most of these farms should turn off so that the price to mine comes back to breakeven in a case of prisoner's dilemma.
But if too much hardware turns off, this leaves mining hardware idle and the door becomes wide open to a 51% attack. It's not clear at what price below breakeven cost to mine a 51% attack becomes a serious threat, but once this threshold is crossed, we're in the "irreparable harm to BTC" risk zone.
And for a person like me, who just wants to see crypto disappear forever this is very exciting.
Maybe those mining farms could be replaced with nice forests soaking up all the carbon they emitted for posterity. One can hope.

How do I bet against all of this?

Microstrategy (MSTR) is, at this point, a bitcoin ETF wearing the skinsuit of a dying software company.
Michael Saylor, MSTR's CEO, is quite the character. I wrote a lot about his lack understanding of what a currency is, but it's on another level to look at the early stages of a bubble pop and decide this is a good time to buy $10M more of the stuff, as seen here
However, this bubble is tame by Michael's standards. Look at the historical stock of his company
What's happening on the left is that Saylor pumped the numbers with accounting fraud then the SEC took issue with the fake numbers. The stock dropped 90% practically overnight. Their accountants, PWC, paid $51M in fines. Saylor and friends paid fines, partly with company stock.
You could also short GBTC, but when Mr. Saylor provides you with an options market instead, why not use it? Shorting on crypto exchanges that might become insolvent in the very event you want to happen with this bet is a bad idea, on the other hand.

Mike can't cash out

The bitcoin market is illiquid and leveraged when it comes to real money coming in and leaving the ecosystem. Buys in the $10M-$100M seemingly move the price of BTC by upwards of $1000 in the last weeks. This means hundreds of millions of real money means tens of billions in movement in BTC market capitalization.
Now imagine what cashing $1.1B of BTC into real money would mean for the price. And this is purely in market terms, before the PR damage from bitcoin's demigod abandoning ship would have second-order effects.
Saylor has painted himself into a corner. Even if he wanted to cash out, he can't.

MSTR fundamentals: Why it should be valued below $10

In early 2020, MSTR was a slowly dying business. The EBITDA has been rapidly evaporating in the last 5 years
At that point, MSTR a stock price of $115 meaning a market cap of $1.1B. This included some $560M of cash they were sitting on. I presume the remaining $550M was an implicit sales premium for the inevitable private equity firm investors expected was going to relieve them of this stock and make the business profitable again.
Of course, they didn't sell.
Instead, they took the $560m they were sitting on and bought $400m of BTC at prices $11k and $13k in late summer 2020. Then, in early December, they took on $600m of debt to buy BTC with at $23k. They also bought $10m more in January at a price of $30.5k.
At this point, we can mostly value MSTR like a trust.

Price the underlying software business as being worth $600M, as the market did before the bitcoin nonsense. If BTC went to $0, this is what we'd value it at, and the MSTR stock should be around $65.
But wait! MSTR took on $650M in debt in December. Their actual value with a BTC priced at $0 should be much, much lower than $65 depending on how you value the debt. You could make an argument it should be in the single digits.
They hold 70,784 BTC. At current prices ($32,000) this is worth roughly $2.2B. With the current market cap of MSTR ($577 stock price), this means MSTR is currently priced at an eye watering $3B premium over fundamental value.

GBTC's 20% premium-to-NAV is a joke compared to the MSTR premium.

How I got a (not really an) HOA disbanded - and destroyed a bitchy "President of the HOA" in the process. Warning: LONG ASS READ! - So long in fact, I had to split it into two parts! This is part 5-8

I was invited by one of the mods to share this here as a mega thread, so here goes...
Edit - apparently this saga was so long that I had to split it into two parts. This is part 5-8.

Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts.
Part 5:
IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division.
These are people with arrest power, by the way. And yeah, that's important later in the day.
When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence.
Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it. Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV.
Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN.
Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well.
I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better.
My friend came over and told me he had something to show me.
He pulled out his phone, and gave me an absolute shit-eating grin.
He made me wait for it.
It was worth it.
Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk.
I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV.
Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent". Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper.
And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house.
With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS).
I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV. She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!"
My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard.
I couldn't help myself. I smiled, and waved.
She flipped me off, turned on her heel, and stomped away.
I've had a permanent grin the rest of the day.
PART 6:
Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally.
As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.).
As I mentioned in the comments in part 5, the Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points.
So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence. Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof.
Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face. I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with. Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name. Again, lots of conjecture, but nothing that could be entered into evidence in court.
Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "stragetic lawsuit against public participation". You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights.
So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something. I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system. I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced".
This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week).
During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece. She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace.
"Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution. Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]." (This is not an exact quote, I may update it if I get a copy of the court transcripts.)
As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best.
We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away.
At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon. At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time. That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt.
Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away. They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit.
My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to ~~squeeze water from a stone~~ get paid myself. Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows.
My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her. Just for grins... Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit.
Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home. So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth. So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate (yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES".
Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank..
I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner.
PART 7 (TAZERS!):
So with the Coronavirus fun and excitement that everyone has been having, most of the courts in our area have slowed way down. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate.
We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle). So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy ~~coming~~ stumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell?
If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a pistol and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt. I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door.
Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the ass. And it did give me a front row seat for the shenanigans that were about to follow.
I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud.
I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything. This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just kill myself right here right now and maybe you'd be happy with that too!".
Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself). So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone.
She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general. It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands.
Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more.
Two steps.
Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her. She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point.
The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the COVID issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date. So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence.
Whoopsie.
As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked. Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified.
I do believe she has picked that shovel back up and dug her hole that much deeper.
PART 7b:
Well, someone messaged me asking for an update - I'll keep it brief:
She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses. She made it abundantly clear that if it weren't for the current mess with COVID, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours. A quick look at google maps and we had our answer "75 feet, your honor". The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time. The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying.
The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe - again once this COVID mess is over.
I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through. Plus the possibilities of appeals, etc.
Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :)
PART 8 - THE END?:
But first, the obligatory TL;DR:
President of a fake HOA is a bitch to my wife. Gets sued, loses her husband, career, car, and house. She tries to sue me and loses. Decides to get drunk and belligerent, gets tazed. And now is convicted of multiple counts of fraud (misdemeanor and felony) plus a bunch more lawsuits filed.
So a slightly longer summary is that when my wife and I bought our home, we were very specific in avoiding HOA's. After moving in, we met the "president of the HOA" behind our house. AT FIRST, she seemed nice enough, but little did we know the insanity that was going to come out of her. So we hired an arborist to take down a hazardous limb from a tree, and weren't able to move the wood onto our property the day of since he finished late and I was heading out of town the next day. The psychopath decided to freak out on my wife, until she browbeat her into moving these wood rounds (some weighing in excess of 100 lbs) by herself. They were stacked neatly, out of the way, and in no way an impediment to foot traffic. She claimed that the area that the rounds were stacked on was private property of the HOA (turns out it wasn't!) and that it needed to be moved immediately.
Well, some time later, some hedges that were growing on the "HOA's private property" pushed over a section of our wooden fence. E-mailed her, and the short version of her reply was that it wasn't their property and wasn't their hedges so we were SOL on getting our fence fixed by them. Waitwhut?
This kicked off a couple of weeks of calling a multitude of county departments to find out who actually owned that chunk of land. Eventually learn that it is actually county property as part of the right-of-way that was ceded to the county for a road. And the reason it took so long to figure this out was that there *was* no HOA registered with the county. So I sent an anonymous letter to everyone in the "HOA" with what I had found out.
Cue everyone in the fake HOA suing her ass for fraud.
Her husband, who was not in on the scam, promptly files for divorce - he wants absolutely no part in this.
IRS and state revenue agency start crawling up her ass for back taxes.
She was a real estate agent and principal broker. Those licenses were revoked by the state. She loses her job.
House goes up for sale, it's listed for abut 15% higher than comps and it's still a short sale - so she's in deep trouble financially.
She gets arrested for interfering with the duties of a federal agent when the IRS comes knockin - and they seize her brand new Mercedes SUV to boot.
Tries to sue me, loses badly, and has to pay my costs and attorneys fees, and I file for a protective order because she's crazy.
Gets drunk and belligerent, violates protective order. Gets tazed by the county mounties for her troubles. Jail again. Stronger restraining order.
That all brings us to the beginning of this final update....
Due to COVID, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case. Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony. I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package.
So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them.
The prosecutor then had to get his last jab in, "So Mr. AmbulanceDriver2, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her?
"What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood."
I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies. I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart. There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated.
Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on.
And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify.
I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far. But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims. Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits. I suspect that number has grown since then.
I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.

Who funded the Jan. 6 rally preceding the insurrection

An heiress to the Publix Super Markets chain, with the help of Alex Jones, funded the "Save America" rally that preceded the January 6 insurrection. Julie Jenkins Fancelli, daughter of Publix founder George Jenkins, provided more than half the cost of funding for the event - amounting to about $300,000 of the half a million-dollar price tag.

Publix: “Mrs. Fancelli is not an employee of Publix Super Markets, and is neither involved in our business operations, nor does she represent the company in any way. We cannot comment on Mrs. Fancelli’s actions.”

Fancelli’s donation was reportedly facilitated by far-right conspiracy theorist Alex Jones, who himself gave $50,000 and was recorded with a megaphone in the crowd of rioters marching to the Capitol building. Video from the sixth shows Jones telling the marchers: “We’re here to take our rightful country back peacefully, because we’re not globalist, antifa criminals. So let’s start marching, and I salute you all.”
His tone the day of the insurrection was markedly different from just hours before, when InfoWars posted video of Jones riling up a crowd of Trump supporters for “warfare”:

“We have only begun to resist the globalists. We have only begun our fight against their tyranny. They have tried to steal this election in front of everyone...I don’t know how this is all going to end, but if they want to fight, they better believe they’ve got one,” Jones said that night, according to the same video.
...InfoWars posted a video that shows Jones riling a crowd up again, saying: “We declare 1776 against the new world order.… We need to understand we’re under attack, and we need to understand this is 21st-century warfare and get on a war-footing….”

Following the insurrection, Jones published a video explaining his role and the violence that occurred.

"By the time I got out there 20 minutes, 30 minutes before Trump finished his speech, there were already hundreds of thousands of people ahead of me marching. And before Trump ever took the stage, antifa, dressed up — over a hundred of them — as patriots, was there,” he said, claiming without evidence that antifa followers were in the crowd.

Fancelli contracted Trump committee fundraiser Caroline Wren and Trump campaign aide Megan powers to organize the Jan. 6 rally, contradicting the campaign’s claim that it was not involved in the event. Wren, a prominent GOP fundraiser, is named on the National Park Service permit as a “VIP Advisor” and is one of three primary contacts listed. FEC records show Wren and her consulting firm have received approximately $900,000 from the Trump campaign, Trump Victory committee, and RNC since April 2017. Powers was paid $290,000 between February 2019 and the election.

The other two contacts on the permit were Women for Trump directors Amy Kremer and daughter Kylie Jane Kremer.
In total, eight rally-organizers have connections to Trump. Mick Mulvaney’s niece Maggie Mulvaney was one of those named on the permit; she was previously paid $138,000 by Trump’s campaign.
Trump’s 2020 campaign paid out over $2.7 million to individuals and organizers with ties to the Jan. 6 rally.

A Republican group headed by Alabama’s Attorney General promoted the Jan. 6 rally using robocalls before the event. AG Steve Marshall leads the Rule of Law Defense Fund (RLDF), a dark money group that fundraises for the Republican Attorneys General Association. He claims he was unaware of the operation conducted in favor of the rally and ordered an internal review.
The robocall stated:

“I’m calling for the Rule of Law Defense Fund with an important message,” the robocall stated. “The March to Save America is tomorrow in Washington, D.C. at the Ellipse in President’s Park between E St. and Constitution Avenue on the south side of the White House, with doors opening at 7:00 a.m. At 1:00 p.m., we will march to the Capitol building and call on Congress to stop the steal. We are hoping patriots like you will join us to continue to fight to protect the integrity of our elections. For more information, visit MarchtoSaveAmerica.com. This call is paid for and authorized by the Rule of Law Defense Fund, 202-796-5838.”

According to a New York Times report, an unnamed donor “demanded” the group create the robocall and “made a contribution contingent upon its release.”
Unfounded claims of a stolen election were extremely profitable for Republicans, with the RNC and Trump-tried organizations bringing in $86 million in the weeks after the election. Trump’s post-presidential fundraising committee - ostensibly created to back legal challenges to the election - is entitled to roughly half of the $86 million. Combined with the committee’s own fundraising stash, Trump now has a $76 million slush fund. He spent none of it on the Georgia Senate run-offs.

“He put nothing back. He didn’t care,” said one top Republican familiar with the fundraising operation who spoke on condition of anonymity, adding that Trump intends to use the money to pay his personal, non-election-related, legal bills. “He put all this money in the bank for his own legal fights. He never cared about Georgia’s races.”

Dark money

The larger organizations that facilitated the rally - like Women for Trump - are fed by dark money. Meaning, we do not know who donated to them.
With the Senate under Democrat control, it is possible that the power of these dark money groups may finally be met with some restrictions. For instance, the Senate Finance Committee is now run by Chairman Ron Wyden (D-OR). Other strong voices on the committee include Sen. Elizabeth Warren (D-MA) and Sen. Sheldon Whitehouse (D-RI).

Just prior to becoming finance chairman, Wyden sent a letter to IRS Commissioner Charles Rettig and called on him to investigate what role, if any, these groups played in the riot. Indeed, pro-Trump dark money organizations helped plan the rally that featured then-President Trump encouraging supporters to march on the Capitol.
Warren and Sen. Sheldon Whitehouse, D-R.I., who is also on the Finance Committee, recently sent a letter to new Treasury Secretary Janet Yellen focusing on dark money groups across the political spectrum.
Wyden said the IRS has informed him that it is reviewing his request.
“The reason I’m so interested in whether tax-exempt organizations were involved with planning or inciting the insurrection is that the law could not be more straightforward and understandable. Tax-exempt organizations cannot be involved in an illegal activity and can’t be involved with inciting an insurrection,” Wyden told CNBC. “We are going to make sure the IRS moves on this promptly.”

House Democrats have also reintroduced HR 1, which would require nonprofits that spend money in elections and on judicial nominations to immediately disclose their donors.

Mea_Wiki has been banned due to the grooming of minors.

MAJOR UPDATE

Mea has confirmed that the account sharing ended at the end of July 2020. As previously established, the second victim's grooming fell under August 2020. She has confirmed now that these messages are real and the conversation did happen. However, she refuses to take responsibility for them, claiming that the victim initiated the conversations (this can't be verified due to her deleting her messages). She has also admitted that she continued to talk with them regardless, partaking in the roleplays with the minor to try to slowly drive them away by chatting with them less and less as opposed to outright telling them to stop, despite the fact it was the victim that blocked contact in the end and she continued to try and get in contact with them via Reddit's chat system (both confirming that she was the one sending the messages without a doubt and that she didn't break off contact for over a month throughout August). Even if her side of the story was true for the second victim's case, as the adult it was her responsibility to break off contact and she is currently victim-blaming. With the first victim's case happening less than a month prior to this event, we are now fully convinced that she was the groomer.

Original Post

Mea_Wiki, a popular artist most well known for her artwork of Vanny and Vanessa, has been banned indefinitely due to her Discord account being used to groom minors.
We were informed over modmail and given screenshots of the grooming messages in question, along with surrounding context such as evidence the minor said their age and Mea asking the victim to stay quiet about her past - with multiple victims coming forward at this point. Mea has also admitted that the grooming did take place and that the messages are real, having confirmed they are present in her chat log. Similarly, all the following information is directly confirmed by Mea herself.
This was Mea's defense: Back in July 2020, Mea let two people she knew in real life use her account in exchange for money. She also agreed to let them pretend to be her on her account (using her online personality that has garnered fans), including mimicking her writing style to trick others. This means that users who talked with her over Discord believed they were talking to Mea, but instead were talking to strangers that paid Mea to use her online personality. Mea also didn't check any of the messages they would send under her name, thus giving them free rein to do as they please without consequence.
Due to this, Mea has claimed that the grooming messages sent from her Discord account in her writing style were instead sent by one of the two anonymous people that had access to her account at the time that she is no longer in contact with. For clarification, her writing style was defined by common patterns in Mea's other messages/comments: text emojis being placed at the end of sentences, ":3" and "uwu" being used, no capital letters at the start of messages, no full stops at the end of sentences, the "soooo cute" being something Mea has said many times in the past with the same amount of "o"s, etc.
Recently, an alt account sparsely used to hate on Mea and post Vanny pornography claimed they were the anonymous person who groomed minors. However, this account has a strikingly similar art style to Mea and the fact it came forward with that message at all after supposedly getting away with it is suspicious to the team, especially when they appeared less than 5 minutes after Mea stated in a comment that she would be trying her best to find the person responsible. In any case, the account can't be verified as one of the anonymous users and thus can't be used as evidence in Mea's favour. Mea's also seemingly contradicted herself when referring to the users she shared the account with: both referring to the anonymous people as "2 others I knew in rl [real life] but I dont have contact to them anymore because of a huge drama" and that "the person didn't give any information except an anonymous moneypool on PayPal". The switching stories and suspiciously similar alt account only paint her in a worse light.
Finally, it is worth noting that we have been talking to the second victim, whom of which as provided more screenshots that allude to the grooming continuing on as far in as 30th August 2020, as well as screenshots of Mea admitting to posting the prior messages in their conversation and deleting them as a result. Once we confirm the exact date that Mea took back full control of the account, we can determine if this second case was within that timeframe. If not then this would be undeniable evidence of her being responsibile for the grooming itself. However please keep in mind this is still ongoing as Mea has elected to delete her accounts, thus preventing any further conversations on the matter to take place between her and the mod team.
With all this information, everything can be narrowed down to only two possible conclusions:

1) Mea groomed minors.

2) Mea willingly gave her account to anonymous people for profit while letting minors think they were talking to her, not checking their activity and thus inadvertently allowing one of those anonymous people to groom minors using her online personality.

While we can't 100% confirm who exactly sent the grooming messages at the time between Mea and one of the anonymous people, both of these conclusions are worth an indefinite ban, as Mea was responsible for what was done on her account and has proven she is a danger to the safety of younger users on the subreddit as a result. As of right now, the ban has been and will remain instated.
This post is being made to clarify why she was banned given the popularity of her works on the subreddit, and to warn users to be wary of grooming.
Please remember that even if they seem trustworthy or are well-known in the community, still be cautious - don't continue to talk to them if you feel uncomfortable and don't be afraid to speak up if you feel that you are a victim of grooming. Additionally, never give your account out to strangers under any circumstance. Finally, please don't harass anyone involved in this situation. Doing so won't help anything and will only cause further problems.

What is Monero? Why is Monero? How is Monero? Everything you need to know in 5 minutes or less.

Flatten the Curve. Part 79. Let's take another look at Cicada 3301. Who is Dan Jefferies and what is the Cicada Project? Because guess what? The project sounds like the Microsoft WO2020060606 patent.

Previous Post Here
The New Normal. The word has been around for a lot longer then we realize. A lot longer. Know what else has been around for a while? New World Order.

Cicada 3301

Cicadas are strange, aren't they? You can't see them unless you look, and yet you can hear them everywhere. An omnipresent sound surrounding your environment. If you live in an area without Cicadas, and then travel to an area with Cicadas, you'll be acutely aware of the sound, and it'll throw you off at first. You'll find the noise annoying, but tolerable. And then slowly without realizing it, you ADAPT. It becomes your NEW NORMAL. And once it does, you don't give the Cicadas a second thought.
And maybe that's a mistake. Maybe there is no maybe, it is a mistake. So we're going to dive deep into Cicada 3301 and how it fits into the Not Normal New Normal.

Break the Code

People can be broken down into two categories, those who like solving puzzles and those who don't. Those who don't are generally ok with the status quo. They don't see anything wrong. They don't realize that the puzzle has missing pieces, and even if they do, they don't mind. Why? I have no idea. That mindset is foreign to me, as it is to anyone reading this series. So let's take a look into the Cicada puzzle peices.

But the challenge to find what was hidden in this picture intrigued him. He stared intently at the image. Someone on the IRC had heard rumors that terrorist groups encrypt secret notes in image files, ones that could be retrieved by opening the file in a different format. Running a text–editing program called Notepad, he opened the image and, sure enough, saw a strange string of words and garbage characters at the end: “TIBERIVS CLAVDIVS CAESAR says ‘lxxt>33m2mqkyv2gsq3q=w]O2ntk.’ ” Caesar, he knew, was one of the most ancient forms of encryption, dating back to Julius Caesar, who used the cipher to safeguard military secrets. It works by taking the alphabet and then counting down each letter based on a designated number (say, replacing letters with ones three letters down the alphabet).

Cicada posted the first puzzle January 4, 2012. 2012 was also the year that the Mayan Calendar predicted the end of the world. Or the transformation of humanity into an enlightened state of consciousness. Obviously the world didn't end. So are we heading into an enlightened state of consciousness? Perhaps. Time will tell, like it always does.

2013, November 25 • Eriksson didn’t realise it then, but he was embarking on one of the internet’s most enduring puzzles; a scavenger hunt that has led thousands of competitors across the web, down telephone lines, out to several physical locations around the globe, and into unchartered areas of the "darknet”. So far, the hunt has required a knowledge of number theory, philosophy and classical music. An interest in both cyberpunk literature and the Victorian occult has also come in handy as has an understanding of Mayan numerology. Source Here

Remember the Mayan Calendar.
Before anyone thinks Cicada was some kind of promotional stunt, or LARP, it wasn't. Nor was it the result of a single individual or a small group of individuals. Because if it was, the following would have been extremely difficult.

There were more than a dozen (Cicada posters with QR codes), spread over four continents. The Street View images seemed random: a narrow street near the University of Warsaw, a parking lot on a busy intersection of Seoul, a country road on the North Shore of Oahu. One location came up in front of a prominent doctor’s house in a wealthy section of Seattle. (When RS called the doctor, he said that he had never heard of Cicada 3301.)
Amid the fervor, an anonymous person posted a mysterious confessional. “I was part of what you call 3301/Cicada for more than a decade,” the anonymous author wrote, “and I’m here to warn you: Stay away.” Any portentously dire and anonymous message on the Internet could be bullshit or trolling. But as the skeptical solvers read the screed, the author seemed knowledgeable enough about 3301 to give them pause. The author said he had been a military officer in an unnamed, non-English speaking country when, after a year of being unknowingly vetted in person, he was recruited by a member of 3301. He described them as “a group of like-minded individuals, all incredibly talented and connected, [working] together for the common good: the good of mankind.” But over several paragraphs, he cautioned about their cultish beliefs, a conviction, for example, in “the Global Brain as another kind of ‘God’ ” – 3301 was nothing more, he wrote, than a “religion disguised as a progressive scientific organization.” He concluded by saying he had since found Jesus. Source Here

The author claimed to be a military officer in an unnamed country. He warned of a Global Brain as another kind of God. Hmmmm.
AI WORLD Government. And don't go thinking this is just some half baked organization trying to make a dollar and meeting in Hotel Banquet halls. Take a look at some of the organizations behind AI World Government. Microsoft. Amazon. IBM. FEMA. Army Research Laboratory. Defense Intelligence Agency. Homeland Security. MITRE Corporation. NASA. IARPA. DOE. NVIDIA.
That's quite the Clubhouse, isn't it? Now take a look at the sponsors on this page If you don't find the sponsor list concerning, i don't know what to say and you should probably stop reading now. And for those of you who realize that Knowing is Half the Battle, Go Joe.

Prime Numbers in the Prime Timeline

Did anyone have Cicadas on their 2020 bingo card? No? That one was conspicuously absent from all those memes, wasn't it?

But researchers think this life cycle is all about tricking cicada predators — making sure that they can't sync up their schedules with the next cicada emergence. The cicadas generally follow an emergence schedule of either 13 or 17 years — both prime numbers. The schedule's indivisibility makes it more difficult for predators to predict the next emergence, research suggests. WHAT DO THEY SOUND LIKE? — One of the most noteworthy parts about a mass cicada emergence is the sound the swarms of cicadas emit. The screech of a cicada has been likened to an "alien-like wail" and "field of out-of-tune car radios." Source Here

This wasn't the only article suggesting that Cicadas have an Alien Like Wail. In fact, it was in a lot of them. And with five corporations owning and controlling the MSM information stream, the Alien Like Wail is something we need to take note of. Do I need to remind you of the sudden influx of UFO disclosure happening from the American Military? It's not a coincidence. It's also not going to be the main focus on this post, but it will be written about shortly in Flatten the Curve. So let's just hope the "Aliens" aren't the predators that we're hiding from. Although I am dying to say, I don't have time to bleed. Or. Get to the choppa.
So the Cicada puzzles involved Prime Numbers, Mayan numerology, and Runes, amongst other clues in their cryptographic and steganographic odyssey. But what other meaning is associated with Cicada, because the group didn't pick a random name out of a hat.

The cicada symbolises rebirth and immortality in Chinese tradition. In the Chinese essay "Thirty-Six Stratagems", the phrase "to shed the golden cicada skin" (simplified Chinese: 金蝉脱壳; traditional Chinese: 金蟬脫殼; pinyin: jīnchán tuōqiào) is the poetic name for using a decoy (leaving the exuvia) to fool enemies. In the Chinese classic novel Journey to the West (16th century), the protagonist Priest of Tang was named the Golden Cicada.

A decoy? I may have forgotten to include something about a decoy and the Cicada puzzles.

"WHOOPS Just decoys this way. Looks like you can’t guess how to get the message out”. Source Here

Clicking on the link takes you to a picture of a duck decoy. And anyone reading this series understands that we may be on the brink of WW3 with China over the environmental collapse that's upcoming, and that this war is also involving the race to AI supremacy, and that whoever controls AI, will now have dominion over the planet.

The earliest known fossil Cicadomorpha appeared in the Upper Permian period; extant species occur all around the world in temperate to tropical climates.Source Here

Whelp. There's something happening here. But what it is ain't exactly clear. There's a man with a mask over there. A-telling me, I got to beware. I think it's time we stop. Children, what's that sound? Everybody look what's going down.
Ahem. Sorry. But seriously, what's going on? Upper Permian period? Really? Ring a bell? It should if you've read Flatten the Curve from the start. Why? Because the BLUE planet that we call home seems to be entering into a period that reminds me of the End Permian extinction event. And that's not good. Trust me. Also, let me explain one more time, that while we are seeing troubling signs in our current environment, this doesn't mean that the ecosystem will collapse tomorrow, or next year, or even this decade. We don't know the timeline, so don't go and join an end times doomsday cult just yet. But be prepared for the unknown as best as you can. Because while the environmental collapse and our future may be unclear, the powers that be still seem bent on starting a war. With each or other, or with something. (Something? Really? What do I mean? Well, who knows if all of the recent Alien disclosure is real or fake, but it's not slowing down. Regardless, it has to be taken into consideration and examined)

Who is Dan Jefferies?

Dan is an Author. Dan wrote a two book series called The Jasmine Wars. Here's the synopsis.

When a Jasmine Revolution sweeps away the brutal Communist regime, China transforms into the world’s first AI-driven Direct Democracy, ushering in a golden age of peace and prosperity unlike anything ever seen in its five thousand year history. Now when an economic shock brings terrorism and ultra-nationalism roaring back, the nation’s favorite son, Colonel Ju-Long, races to uncover the traitors in his midst before his beloved country explodes into another devastating civil war. Source Here

AI Driven Direct Democracy. Sounds kind of like the AI World Government, doesn't it? Or maybe it's the opposite. Or maybe it's the same thing we have now, a Democracy that only works because it gives us the illusion of choice.
But he's only an Author, you might be thinking. Isn't this taking it a little bit too far? Seriously Greek, you may be losing it. Should you take a vacation and relax, get your head on straight again?
Long story short, no. I'm good. Completely and utterly good. Maybe working a little too much, and maybe I'll need a vacation after the pandemic protocols have been (hopefully) uninstalled, but not yet. And definitely not now.
So Dan's an author, but what else is he? Because it’s a really odd world up above us. Seriously odd. Because while we struggle with having a life and a single occupation, those who worship in this AI technocracy seem to be able to multi-task like the spooky action of quantum entanglement.

DANIEL JEFFRIES • Author, Futurist, Thinker, Engineer, Systems Architect, Podcaster, Pro Blogger. Science Fiction: Daniel is the author of four cutting edge sci-fi novels, including the popular nanopunk epic The Scorpion Game, which readers have compared to the early cyberpunk masterpiece Neuromancer. Pro BloggePodcaster: His massively popular Medium blog with over 50K followers, and his Daily PostHuman podcast covers a wide range of future tech from artificial intelligence to cryptocurrency. His articles have appeared in Bitcoin Magazine and he’s the number one writer for the popular magazine Hacker Noon. Engineer: For more than twenty years, Daniel created and implemented advanced tech solutions for early web companies and Fortune 500 companies, first with his own consulting company and later for open source pioneer Red Hat, using Linux, virtual machines, Docker containers and DevOps and now for the innovative MLOps AI startup, Pachyderm. Systems Architect: Daniel now designs cutting edge crypto and decentralized web platforms, starting with the Cicada concept project, and then rolling its ideas into stealth startups with gamified money solutions, decentralized IDs, reputation systems and advanced crytoeconomics architectures. Public Speaker: He’s also a well respected public speaker, having given talks all over the world on the future of cryptocurrency and artificial intelligence.

That's the kind of bio that leaves you feeling like an underachieving peon, doesn't it? Kind of like the bio of Lance B Eliot, isn’t it? Well, not quite, but it's still impressive. But he's not an AI algorithm like Lance (at least I don't think he is) seems to be. So why did I include him in this post about Cicada 3301? Did you notice that in his bio there is something called the Cicada Concept Project? Yeah. Strap in and hold on, cause this roller coaster is about to start.

The Cicada Concept Project.

So Dan Jefferies came up with the Cicada Project, does that mean that he also came up with or is a member of, Cicada 3301?

Oh yeah. I mentioned Cicada 3301. A lot of people have asked me over the years if I’m involved with that project or if I’m behind the mystery in some way? The answer is no. But it’s also not that simple. Of course, some asshole on Reddit will inevitably post this in the comments: Is Dan Jeffries behind Cicada 3301? TLDR. No. LOL. I just saved his lazy ass some time. He can cut and paste it. Source Here • (I strongly recommend reading his post. Make the time.)

LOL! OMG, that's too funny, don't you think so too? Dan Jefferies the writer and Cicada 3301, give me a break! Don't be that a$$hole on Reddit and make unsubstantiated claims, ok Greek?
Uh. Nope. Not ok. And my name is Biggreekgeek, not a$$hole. And if you insist on that nomenclature, then that's Mr. A$$hole to you. Because if it looks like a duck and quacks like a duck, then it's probably a 3301 Duck Decoy.
Call me crazy, but I'm finding his assertion that it's all a mere coincidence too convenient. Now I know that you can't prove a negative, but trying to explain the name connection away by claiming synchronicity and it's just a result of the universe laying out your path, well, that doesn't work for me (read his post, this is what he actually claims).

Jasmine Wars • In the story Cicada is a massive distributed artificial intelligence and nation-state operating system. She’s a voting and communications platform and a fantastic alien mind. In many ways she embodies the best of the human race, while mitigating the worst of our dark dual natures. She seemed like the perfect choice for a chunk of killer future tech so I set out to create an early version of her.

Now let's do a little coincidence checklist for our New Normal reality.

Nation State Operating System • Ai World Government. ✔
Ultra Nationalism. ✔
Voting Problems. ✔

Strange how so many current events could be solved by the Cicada platform. And what about that curious word choice of a Fantastic Alien Mind? It might not rhyme with Orange, but didn't a lot of the 2020 articles about Cicadas mention an Alien-like wail? Yes. They. Did. Are you enjoying this roller-coaster yet? I hope so, cause this ride isn't going to be over for a while, despite the promised land just being two weeks away. (Edit: I've had this written for a while, but held back. Why? To see how the times went as we moved forward. And now we have our answer)
Before we carry on like the wayward sons we are, let me give you the link to the Cicada Concept Project. Source Here READ IT!

Let's Pull It All Together.

Dan Jeffries is the chief technical evangelist at Pachyderm. Evangelist. His title at Pachyderm is a little strange, don't you think? Cause I do. Really strange. Let's look up what the definition of an Evangelist is, shall we?
e·van·ge·list /əˈvanjələst/ • noun • 1. a person who seeks to convert others to the Christian faith, especially by public preaching.
Cute, isn't it? Nice little wordplay there. Not freaky at all. Nope. Sign me up to the cult.
So Danny Boy came up with a concept called Cicada that can be a Direct Democracy system that uses secure BIO-ID, protects your privacy, and who's participants generate Cryptocurrency biologically. Didn’t some company get involved with these concepts at some point? I think so. What company was it? Hmmmm, let's see...was it...MICROSOFT?
ID2020 SOURCE HERE WO2020060606 - CRYPTOCURRENCY SYSTEM USING BODY ACTIVITY DATA Source Here
Yep. It was Microsoft. And guess who else Microsoft is involved with?

2020, August 19 • Pachyderm Secures $16 Million Investment Led by M12 - Microsoft’s Venture Fund • Company raises Series B round on back of Fortune 500 enterprise adoption. SourceHere

AI WORLD GOVERNMENT is sponsored by Microsoft as well.

Ah Billy Boy, you sure are one clever little bugger, ain't ya? I've said it before and I'll say it again, AI will be the savior that will solve the Pandemic problem. Eventually. Some day. Not soon. Definitely. Not. Soon. Why? Well the pandemic disruption hasn't reached the proper level of disruption yet, that's why. (And should I point out that M-12 reminds me of MJ-12, or, Majestic 12)

Final Words.

Look. The Big Picture of Big Brother isn't an easy one to see, and it's an even harder one to explain. Like it or not, we're living in an epoch of civilization, a pivotal moment in time. The deeper I dig, the deeper my limited understanding becomes. This is disruption by design. And yet, I'm left wondering is this is a human designed disruption, or are we dealing with an unknown AI construct capable of not only deceiving and manipulating us common folk to advance an endgame, but also manipulating those who have engineered it. Implausible? Don't be too confident in that assumption. Why? Do you remember Billy Boy Gates smug look in certain interviews where he was advocating the vaccine? It reminded me of that look that parents get when their child just doesn't understand something they're trying to explain. "One day you'll understand". We've all heard that at one point by our parents, haven't we? And yet something changed in Billy Boy as the pandemic went forward and nobody was embracing him as our very own Marvel Superhero. His look went from smug to exasperated, almost confused. It was almost like he felt society wasn't acting in a preordained manner, as though a carefully thought out BLUEprint was suddenly developing problems out of the BLUE.
I know everyone likes to talk about a plandemic. And I know that the majority of readers in this subreddit like to call it a low mortality virus, and maybe it is. But I find it hard to accept that human agents came up with something this intricate in depth and overarching in scope. Seriously. Just think about Cicada 3301 > Dan Jefferies > Microsoft Patent 060606. Because the similarities are too close for my liking to be coincidental. Especially when you consider the continued chaos of the economy, wealth inequality, tax evasion, the elections, the racial tensions, issues of policing and abuse of power, and I hope that I'm wrong, but it even appears that we may have even more upcoming chaos in our trust of the scientific research institutions and corporations. Out of chaos, order. Right? What order? AI world government. New World Order. New Normal. Great Reset. Build Back Better. Everyone has to be on board the Great Reset, right Klaus fourth industrial revolution Schwab?

October 18, 2019 • She noted that the number of people using the Internet exceeded half of the world’s population in 2018, with 80 per cent of Europeans having access compared to less than 25 per cent in Sub‑Saharan Africa. Almost half the world’s population remains offline and excluded from the benefits of digitalization. Source Here

Less than 25% in Sub-Saharan Africa have access to internet. And now we have Operation New Normal happening in Africa. Flatten the Curve. Part 60. Source Here
And don't forget the military backed starlink to provide worldwide internet for those who aren't connected yet. Yeah. We're All In This Together. Right?
Nicholas Negroponte is the founder and chairman Emeritus of Massachusetts Institute of Technology's Media Lab, and also founded the One Laptop per Child Association (OLPC).
Ah right. The failed attempt to get every child a laptop. From Nicholas Negroponte who accepted money from Jeffrey Epstein’s tangled web of foundations. And I quote; "If you wind back the clock, I would still say, 'Take it.'"
Charming. The ends justify the means. Remember that. Wake up every day and repeat it to yourself. The ends justify the means. Why? Because that's how a lot of them think, and we are the means to the ends.
Heads up and eyes open. Talk soon

QANON, The Storm, and the Great Awakening: the Masonic mass deception on the brink of the End of the World to summon the agendas and the adoration of the Antichrist, Donald J. Trump, the Chosen One.

The True Identity of the Tattered Prince

Link to video if you would rather watch and listen than read: https://youtu.be/39uZjZtK-YM (There is a couple show spoilers in the video I didn't include in this write up)
The Tattered Prince, Captain of the Windblown, cuts a striking figure in ADWD. The rogueish and twisty captain has a particular habit of ripping strips of clothing from the raiments of his fallen enemies. They’re sewed into a multi-colored cloak that billows behind, a grim reminder to his enemies as they face the deadly exiled Prince of Pentos and of how many have fallen to him . His tatters serve as his identity, and yet it really tells us nothing about the man. Before he ran from Pentos, Tatters had a name, a house, a life. Tatters, as he’s called by his Windblown brethren, is framed by George as a mystery for the reader to see if they can puzzle them out. In the same book, Tyrion is deducing the true identity of Griff to actually be the exiled lord Jon Connington in disguise. Perhaps Tatters is another long lost Westerosi hiding behind a fake identity, another puzzle to solve. Challenge accepted George! In this video I will be taking the great and powerful turtle’s bait and figuring out exactly who this Tattered Prince really is. Rip his mask off scooby doo style like I did previously in my videos on the Tattered Prince’s trusted employees, Pretty Meris and Caggo Corpsekiller and see who hides beneath the tattered cloak.

The Five Year Gap

Before we jump into that, an important thing to bring up is the five year gap. When George abandoned the Five Year gap, he was already well into writing the arcs of his characters. He didn’t want to let them go though, and some of those arcs and plot points have been preserved elsewhere in ADWD and AFFC. In my Pretty Meris video, I argued that Pretty Meris of the Windblown was one of those salvaged ideas; an alternate future for Brienne of Tarth. And in the Tattered Prince, I believe the same thing is going on.

George often plays with his characters like this, using side characters and his other stories to play out character arcs and plots he didn’t use. Like for instance very clear parallels between the Victarion Greyjoy’s fire arm and Aerea Targaryen’s fire wyrms, Rhaenyra Targaryen and Cersei Lannister, Aegon the Unworthy and Robert Baratheon, Brienne of Tarth and Podrick Payne to Duncan and Egg, among many many others. He uses these as a way of exploring the road not taken for himself and also to aid the reader in understanding the choices he made.

The Would-be Prince

First let’s get a refresher on ole Tatters. Before he was Tattered and a prince, Tatters was a nobleman in the city of Pentos and a member of the forty families that descended from Valyria living la vida loca. And then one fine day the magisters of Pentos elected young Tatters as their new prince. Great right? Well not so much. They hadn’t finished cleaning up from beheading the previous prince hours earlier yet. The Prince is the sacrificial lamb of the city of Pentos that the council of magisters kill when the fortunes of the city turn sour. Being named Prince meant Tatters knew that he would have a short life before being murdered to pay for the mistakes of the magisters. Tatters refused to become prince, grabbed his sword and a horse and ran from power becoming a sellsword in the Disputed Lands.

What this establishes is that Tatters is someone who wishes to make their own choices, not live at the mercy of a council of magisters, and a man of ambition. While he would’ve been wealthy and treated as royalty as prince of Pentos, he would have no self-determination of that life.

Tatters served in many sellsword companies before forming his Windblown with five compatriots. Of those six founders, mysteriously only Tatters has managed to survive to the current day. With the Windblown, he achieved wealth, power, fed his ambition, and had autonomy in a world where so few do. He thrived to spite the city of Pentos in his act of personal rebellion.

I’ve been calling him Tatters as we don’t know his true name, instead his identity is tied up in his cloak. His Tattered cloak is one he has made over the years sewed from scraps ripped off of surcoats of his recently dead foes which serves as the Captain of the Windblown’s identity card wherever he goes

his ragged cloak was made of twists of cloth of many colors, blue and grey and purple, red and gold and green, magenta and vermilion and cerulean, all faded by the sun
ADWD The Windblown

He comments to Quentyn Martell on how people recognize his cloak rather than his actual features.

"My ragged raiment?" The Pentoshi gave a shrug. "A poor thing … yet those tatters fill my foes with fear, and on the battlefield the sight of my rags blowing in the wind emboldens my men more than any banner. And if I want to move unseen, I need only slip it off to become plain and unremarkable."
ADWD The Spurned Suitor

A trick we’ve seen done elsewhere in ASOIAF before in Mance Rayder who removed his own scarlet and smoke cloak to become Abel the Bard and sneak into Winterfell. It’s a common idea, there’s no social media in Westeros so unless you personally know someone’s face it can be easy to disappear with small tricks. Although the Tattered Prince does undersell his appearance as plain and unremarkable a bit.

Tatters has features that might seem common in Essos, but not in Westeros. Being of a noble Pentoshi birth of the forty families, Tatters most likely had Valyrian features that age and battle have worn down over time. Over 60 years old,these days his defining features are his eyes and hair.

In the yellow candlelight his silver-grey hair seemed almost golden, though the pouches underneath his eyes were etched as large as saddlebags.
ADWD The Spurned Suitor

Golden, silvery hair is a very common feature among Valyrian descendants like the Pentoshi. His eyes “sad” and showing marks of how little the prince sleeps. Tatters’ way of handling himself and his posture though tell a different story, as we see from Quentyn Martell and Tyrion Lannister. They describe him as having elegance, grace, power, and command. A leader of men that knows how to project authority.

An old man he was, past sixty, yet he still sat straight and tall in the high saddle, and his voice was strong enough to carry to every corner of the field.
ADWD The Windblown

One was an elegant Pentoshi, grey-haired and clad in silk but for his cloak, a ragged thing sewn from dozens of strips of torn, bloodstained cloth.
ADWD Tyrion X

When he’s not leading in the field however, the Tattered Prince is a bit of an asshole. He openly mocks those around him often by giving them his cutting assessments. The Windblown is a company of many cruel nicknames, with Quentyn Martell picking up the name “frog” as a reference to his quickness at following orders but also a jape at his wide, unhandsome face. A habit reinforced by their commander who enjoys needling people with them.

The Tattered Prince sipped at his wine. "So … no wedding for Prince Frog. Is that why you've come hopping back to me? Have my three brave Dornish lads decided to honor their contracts?"
ADWD The Spurned Suitor

A self aware asshole, Tatters knows how people feel about him, and seems to revel in that reputation. Even using his bad reputation to his advantage when he commands the Westerosi members of his company to turn cloak as a ruse.

The best ruses always have some seed of truth," said the Tattered Prince. "Every one of you has ample reason for wanting to abandon me.
ADWD The Windblown

More than just a self aware asshole, some may even call him cruel. Tatters is especially cruel with deserters who broke their contracts to serve him. Quentyn is well aware that his desertion will mean death, that the Windblown will hunt down deserters and deliver them exquisite pain. He uses these threats of extreme violence as a tool for obedience.

It's desertion whenever we do it," argued Gerris, "and the Tattered Prince takes a dim view of deserters. He'll send hunters after us, and Seven save us if they catch us. If we're lucky, they'll just chop off a foot to make sure we never run again. If we're unlucky, they'll give us to Pretty Meris."
ADWD The Windblown

The Tattered Prince gave a shrug. "Every turncloak has his tale. You are not the first to swear me your swords, take my coin, and run. All of them have reasons....Another fellow told me our food was so wretched that he had to flee before it made him sick, so I had his foot cut off, roasted it up, and fed it to him. Then I made him our camp cook. Our meals improved markedly, and when his contract was fulfilled he signed another.”
ADWD The Windblown

Tatters also has an incredible amount of selfishness. It’s well-known that sellsword commanders take the largest share of the contracts they make. Tatters also constantly breaks contracts as the wind blows for the most profit creating bidding wars among his employers. When faced with competing contracts and vows, he tends to choose the one that helps him the most. Tatters though seems to push the envelope in that regard.

The plunder from Astapor was much less than you were promised in Volantis, and I took the lion's share of it.
ADWD The Windblown

Adding this all up, we get a fascinating portrait of a character that should by now be sounding a bit familiar. Someone you know well. An elegant and well trained soldier skilled in leading armies. An unabashed jerk with a sharp tongue who uses his reputation and trappings of power to get what he wants, often using past examples of violence. A man with golden hair who uses their soiled cloak as their identity. A man without scruples who demands the lion’s share and runs from power at a young age seeking a life on his own terms.

A Lion in disguise

That’s right, the Tattered Prince is none other than Jaime Lannister. The Lion of Lannister, Prince of Casterly Rock, the soiled knight, the Kingslayer. Not the Jaime we know though, not the one who went to Raventree Hall and negotiated a peace with the Blackwoods and Brackens, ignored Cersei’s letter pleading him to return, threatened to catapult Edmure Tully’s child against a castle wall, no. This Jaime Lannister is, much like Pretty Merris and Brienne, an alternate future version of himself. An idea that George toyed with and discarded about how he could write his Kingslayer.

This has to do with the five year gap and how George writes his novels.Recalling our earlier discussion about the 5YG, we know that George takes earlier plot and character ideas and refashions them as new ideas come into focus. But these unused character arcs and plots are not gone - they’re still in his head. And sometimes those ideas are reincarnated on the page in characters like Pretty Merris, Caggo Corpsekiller, and the Tattered Prince.

George draws two fairly striking comparisons between Jaime and Tatters. The first is physical appearance. No one could mistake the handsome, golden haired Lion of Lannister for an aging man with bags under his eyes right? Jaime is not a person that could ever be anonymous. Not so fast, in ASOS when Jaime is returned by Brienne to King’s Landing the previously realm renowned Lannister is unrecognizable.

"The realm knows Jaime Lannister as a beardless knight with long golden hair. A bald man with a filthy yellow beard may pass unnoticed. I'd sooner not be recognized while I'm in irons."
ASOS Jaime I

Partly by choice, during his journey he had his cousin Cleos shave his head and let his beard grow out. Anonymous, and worn down by his journey not even his brothers on the Kingsguard recognize the Kingslayer.

Ser Meryn Trant's droopy eyes went wide. "Ser Jaime?" "How nice to be remembered. Move these men aside."
ASOS Jaime VII

When he heard the door open, he closed the White Book and stood to receive his Sworn Brothers. Ser Osmund Kettleblack was the first to arrive. He gave Jaime a grin, as if they were old brothers-in-arms. "Ser Jaime," he said, "had you looked like this t'other night, I'd have known you at once."
"Would you indeed?" Jaime doubted that. The servants had bathed him, shaved him, and washed and brushed his hair. When he looked in a glass, he no longer saw the man who had crossed the riverlands with Brienne . . . but he did not see himself either. His face was thin and hollow, and he had lines under his eyes. I look like some old man. "
ASOS Jaime VIII

This is almost exactly what we heard previously from Tatters on his method of disguise. Jaime at this moment looks more like the Prince than ever before with thinned features and lines under his eyes. Although Jaime has no multi-colored cloak as his identity, he does have two highly recognizable cloaks. The white cloak of the Kingsguard and his Lannister gold and crimson. He only needs to shed those and cut his hair, and suddenly the most infamous man in the seven kingdoms is another bystander. Much like Arya is taught by the Faceless Men, playing on expectations is half the battle of disguise. This lesson is one that Tatters and Jaime both understand and demonstrate perfectly to go from famous to anonymous with tools far less impressive than magical masks.

The two share the same type, color, and decoration of their horses. Tatters himself rides a “huge grey warhorse” which also has a multi-colored cloak.

His stallion's spotted hindquarters were covered with ragged strips of cloth torn from the surcoats of men his master had slain.
ADWD The Windblown

The same as Jaime’s destrier during his time in the Riverlands in AFFC and ADWD.

His palfrey was a blood bay, his destrier a magnificent grey stallion. It had been long years since Jaime had named any of his horses; he had seen too many die in battle, and that was harder when you named them. But when the Piper boy started calling them Honor and Glory, he laughed and let the names stand. Glory wore trappings of Lannister crimson; Honor was barded in Kingsguard white.
AFFC Jaime II

The same trick is easily done with his grey stallion as with Tatters’ grey warhorse. Remove the signature kingsguard trappings and Lannister crimson, and they could be any other horse on a battlefield - or riding through a gate like Meereen to the fighting pits.

Their personalities are also remarkably alike for instance their streaks of being insulting jackasses. Tyrion is generally considered the Lannister with the sharpest tongue, but Jaime is no slouch. He spends most of the books dropping devastating one liners and roasting those around him like he’s the Mad King.

"I shall rule until my son comes of age." "I don't know who I pity more," her brother said. "Tommen, or the Seven Kingdoms."
AFFC Cersei I

"I learned from Ser Arthur Dayne, the sword of the Morning, who could have slain all five of you with his left hand while he was taking a piss with the right."
ASOS Jaime VIII

By the time I'm done no man will ever know that a castle once stood here." Jaime got to his feet. "Your wife may whelp before that. You'll want your child, I expect. I'll send him to you when he's born. With a trebuchet."
AFFC Jaime VI

Jaime is cruel as well as Tatters. Threatening to fire an infant with a trebuchet into a wall? Shoving Bran Stark to try and kill him? Killing Aerys and Rossart with his own blade rather than keeping them alive for justice? He similarly uses his reputation as the Kingslayer to push people around and make believable threats.

I name this ship Tatterris

Although Jaime always saved his best insults for Brienne of Tarth. During their journey back to King’s Landing together, Jaime made sure Brienne knew exactly how ridiculous, ugly, and idiotic he thought she was.

"When I quarrel I do it with a sword, coz. I was speaking to the lady. Tell me, wench, are all the women on Tarth as homely as you? I pity the men, if so. Perhaps they do not know what real women look like, living on a dreary mountain in the sea."
ASOS Jaime I

"Have no fear, wench. Your thighs are purple and green, and I'm not interested in what you've got between them."
ASOS Jaime V

Over time Jaime begins respecting Brienne more, it doesn’t stop him from roasting her like they were at a comedy club. Tatters has a very similar relationship with his right hand woman, Pretty Merris. He often teases her in a very similar way, particularly about her lack of breasts. While talking with Quentyn Martell,

"You brought three men," Ser Gerris pointed out, with an edge in his voice. "We agreed on two apiece."
"Meris is no man. Meris, sweet, undo your shirt, show him."
"That will not be necessary," said Quentyn. If the talk he had heard was true, beneath that shirt Pretty Meris had only the scars left by the men who'd cut her breasts off.
ADWD The Spurned Suitor

And Jaime doing much the same, mocking Brienne. Which as I pointed out in my Brienne Pretty Meris video is one of the major similarities between the two characters. Their relative unattractiveness and physical scars.

Or would Ser Brienne be more to your taste?" He laughed. "No, I fear not. You can trick out a milk cow in crupper, crinet, and chamfron, and bard her all in silk, but that doesn't mean you can ride her into battle."
ASOS Jaime I

With Brienne, and the insults gradually fall into respect, an attraction growing between the pair. Jaime begins trusting her more than anyone else, arming her with the recently reforged Valyrian Steel sword, Oathkeeper, to find Arya and Sansa Stark. An insanely generous gift, worth more than all the gold in Casterly rock.. Jaime grudgingly admits her skill and value.

"That was unworthy," he mumbled. "I'm a maimed man, and bitter. Forgive me, wench. You protected me as well as any man could have, and better than most." She wrapped her nakedness in a towel. "Do you mock me?"
ASOS Jaime V

Tatters also treats his Brienne as his most trusted and capable soldier. He goes so far as putting her in charge of not only Quentyn’s plot to steal the dragons with Caggo, but also to deliver the secret messages and negotiate with Daenerys about their switching sides.

"Meris will command you," said the Tattered Prince. "She knows my mind in this … and Daenerys Targaryen may be more accepting of another woman."
ADWD The Windblown

"As you say." Ser Barristan lowered his voice. "Your Grace. We set the woman Meris free, as you commanded. Before she went, she asked to speak with you. I met with her instead. She claims this Tattered Prince meant to bring the Windblown over to your cause from the beginning. That he sent her here to treat with you secretly, but the Dornishmen unmasked them and betrayed them before she could make her own approach."
ADWD Daenerys IX

If Jaime Lannister were in charge of a sellsword company, the deep level of trust and confidence he has in Brienne would lead to a relationship nearly identical to that of Tatters and Meris. I believe that is a key element of how they are so similar. Brienne is an important and valued part of Jaime’s life, the same as Merris to Tatters.

The Smiling Knight

Jaime is also a prince of sorts, and no I don’t mean the tinfoil that he is Aerys’ son. Rather, Jaime shares this backstory of a young lordling of an ancient powerful family who refused power to follow a life of adventure and battle. Tyrion says of his older brother only three chapters before we meet the Tattered Prince

My brother, Jaime, thirsts for battle, not for power. He's run from every chance he's had to rule.
ADWD Tyrion VI

Jaime stood to inherit the whole of the Westerlands, becoming one of the most powerful lords in Westeros. With it would come a life of politics, court, power, and a dangerous game of dancing with the dragons of House Targaryen. This is a life that our Jaime never wanted. When Jaime was a squire for Arthur Dayne, he got his first taste of battle and adventure when they hunted down the legendary Kingswood Brotherhood. They fought the outlaws, parlayed with the locals, and lived a true adventure and hunt.

From there, Jaime refused his birthright and, through machinations of Cersei and Varys, was named to the Kingsguard at only 15 years old. Partly for his desire to be near Cersei for some twincest, but he also had a taste of the soldier’s life. He didn’t want Casterly Rock, he wanted adventure. A chance to run enemies through with his sword and learn from the best like Barristan the Bold, Arthur Dayne, Gerold the White Bull Hightower, Prince Llewyn Martell. To prove Tyrion’s point, George has Jaime demonstrate this.

"We are his heirs, Jaime," she whispered. "It will be up to us to finish his work. You must take Father's place as Hand. You see that now, surely. Tommen will need you . . ."
He pushed away from her and raised his arm, forcing his stump into her face. "A Hand without a hand? A bad jape, sister. Don't ask me to rule."
AFFC Cersei I

In AFFC, Jaime pulls a Tattered Prince and disappears into the Riverlands, trying to bring peace, but also questioning his loyalty to his new King and son Tommen as well as Cersei. George is very carefully laying out the scenario in his post five year gap books that Jaime again ran from power.

That’s how Tatters and Jaime are similar, but what about where they split? In the original 1993 outline, GRRM initially had a very different idea for the life of Jaime Lannister. Rather than the internal struggle of Jaime deciding between his vows and personal desires, the Kingslayer didn’t stop at slaying one king. Instead Jaime would have killed his way to being King of Westeros.

Tyrion Lannister will continue to travel, to plot, and to play the game of thrones, finally removing his nephew Joffrey in disgust at the boy king's brutality. Jaime Lannister will follow Joffrey on the throne of the Seven Kingdoms, by the simple expedient of killing everyone ahead of him in the line of succession and blaming his brother Tyrion for the murders.
The Pitch Letter

You can still see parts of it in AGOT where George was setting up villainous rogue Jaime to be fit for the crown of Westeros. Most notably an infamous line of foreshadowing from Jon Snow when he sees Jaime riding into Winterfell in the opening chapters.

Ser Jaime Lannister was twin to Queen Cersei; tall and golden, with flashing green eyes and a smile that cut like a knife. He wore crimson silk, high black boots, a black satin cloak. On the breast of his tunic, the lion of his House was embroidered in gold thread, roaring its defiance. They called him the Lion of Lannister to his face and whispered "Kingslayer" behind his back. Jon found it hard to look away from him. This is what a king should look like, he thought to himself as the man passed.
AGOT Jon I

The intention being that the drastic appearances between King Robert and Jaime planting that seed in the mind of the reader that the Kingslayer would one day sit the Iron Throne. A seed he never developed until the Tattered Prince took shape in his mind. Tatters elegance, command of battle, leadership, royalty all fit when you look back at the original Jaime. A more selfish, out for himself version. The man Jaime was always meant to be.

This is where we get an outline of the twist for how Jaime becomes the Tattered Prince. Starting in ASOS, not only is Jaime running from power, he begins judging his actions in a curious way. He recalls vividly the defining moment of his young life when, as a squire, he joined Ser Arthur Dayne and his detachment of soldiers to hunt the infamous Kingswood Brotherhood.

And he'd held his own against the Smiling Knight, though it was Ser Arthur who slew him. What a fight that was, and what a foe. The Smiling Knight was a madman, cruelty and chivalry all jumbled up together, but he did not know the meaning of fear. And Dayne, with Dawn in hand . . . The outlaw's longsword had so many notches by the end that Ser Arthur had stopped to let him fetch a new one. "It's that white sword of yours I want," the robber knight told him as they resumed, though he was bleeding from a dozen wounds by then. "Then you shall have it, ser," the Sword of the Morning replied, and made an end of it.
ASOS Jaime VIII

After A Storm of Swords, Jaime is going through a personal transformation of character and self reflection that he really has never done before. This transformation begins by losing his hand, but also through the influence of Brienne whose idealism and commitment to justice have a profound effect on Jamie. He begins defining his actions in a binary way: Smiling Knight or Arthur Dayne, functioning like the angel and devil on his shoulders.

The world was simpler in those days, Jaime thought, and men as well as swords were made of finer steel. Or was it only that he had been fifteen? They were all in their graves now, the Sword of the Morning and the Smiling Knight, the White Bull and Prince Lewyn, Ser Oswell Whent with his black humor, earnest Jon Darry, Simon Toyne and his Kingswood Brotherhood, bluff old Sumner Crakehall. And me, that boy I was . . . when did he die, I wonder? When I donned the white cloak? When I opened Aerys's throat? That boy had wanted to be Ser Arthur Dayne, but someplace along the way he had become the Smiling Knight instead.
ASOS Jaime VIII

The Kingswoods Brotherhood 2.0

In the course of feast dance, Jaime chooses to stay true to Arthur Dayne even as he scoffs at Cersei’s pleas for help. He sorts out the Blackwoods and Brackens without a battle. Ends the siege of Riverrun with some gruesome threats that again resolves a possible battle without any blood spilled. But what if he didn’t? Instead of charging Brienne with finding the Stark girls at the end of ASOS and giving her Oathkeeper, Jaime went with her instead? Ride off on another quest as a soldier in the field again, like riding with Arthur Dayne. Tearing off his kingsguard whites and Lannister crimson and gold, fashioning them into a patchwork cloak. Finally freed from his courtly duties, free to fight the battles he wants and never be commanded again by anyone again. His own company, his own life. A smiling knight.

Where would that take Jaime and Brienne after five years though? They’d have no money between them, no Stark girls to protect. Embracing his Smiling Knight side, Jaime could find companions over time to ride with. Cast offs from the wars, veterans of the Brotherhood without banners, who recognize Jaime’s impressive skills in command with Brienne’s deadliness with a blade. A new Kingswood Brotherhood, forming around the core of trust between Jaime and Brienne - the soiled Knight and Brienne the Beauty replacing his missing right hand. This makes the rest of the Windblown possibly doppelgangers of characters we meet in the Brotherhood without banners and other minor characters we meet throughout Jaime and Brienne’s journey through the Riverlands.

This is the only path forward the BWB has as a sustainable organization. In ADWD and AFFC, the Brotherhood has fallen on hard times. They lack for food and supplies, pushing away potential allies in the Riverlands with extreme violence. Once a moral, purposeful organization led by Beric, Stoneheart’s new Brotherhood is described by Thoros of Myr as just ordinary outlaws - and they have very few options. Be defeated by the throne, like the Kingswood Brotherhood, dissolve, or, become mercenaries for hire. After living lean for so long in the woods, the veritable oceans of gold sellswords would seem like a dream come true. You'll ride to battle with the Tattered Prince and come home richer than a lord as the saying goes.

And that is the trick of the Windblown, the Tattered Prince, Pretty Merris, Caggo, and the rest. They are this alternate universe, five year gap version of George’s riverlands plot. Except instead of placing them in the Riverlands where they would be in conflict with Stoneheart’s group, they are hidden within Essos by our author. Across time and space, this alternate future of Jaime’s kingwood brotherhood that has been blown by the west wind Zephyrus marooned in a strange land.

That Tattered Prince. The Smiling Knight. The prince who ran from power. They’re the same person at their core, different versions of Jaime Lannister playing out different plotlines. One who chose to be Arthur Dayne and one who chose the Smiling Knight. Looking at the Tattered Prince this way not only gives the reader a fascinating view into George’s writing process with the Kingswood Brotherhood 2.0, but also who Jaime may end up becoming in the final books. Leaving behind his kingsguard vows, gold and crimson of House Lannister, the expectations of Tywin, his love of Cersei, his brother’s jokes, and trying to just be Jaime. A prince with a tattered cloak riding away with just his sword and horse, making his own destiny for once.

TL:DR Like I proposed with Brienne and Pretty Merris and Sandor Clegane and Caggo Corpsekiller, the Tattered Prince is another not chosen future of a character we know and love. Tatters is actually Jaime Lannister, a fusion of his pitch letter self and a Jaime who left with Brienne into the Riverlands rather than staying with Cersei and on the Kingsguard.

Thank you to bryndenbfish, glass_table_girl, and zombie-bait for their help with this theory, could not have finished it without them.

what is anonymous letter meaning video

Send someone a secret admirer letter or gift. Get a letter to an ex-spouse without disclosing where you live. A way to identify yourself with an area for business reasons (home base). Cards or letters from the Tooth Fairy. Report an illegal activity to law enforcement. Send an anonymous letter to report an affair. Letters Anonymous is an online platform for people to submit their letters anonymously. Because everyone has a letter to write. adjective. without any name acknowledged, as that of author, contributor, or the like: an anonymous letter to the editor; an anonymous donation. of unknown name; whose name is withheld: an anonymous author. lacking individuality, unique character, or distinction: an endless row of drab, anonymous houses. written, given, made, etc. by somebody who does not want their name to be known or made public. an anonymous letter. without any unusual or interesting features. long stretches of dull and anonymous countryside. new housing estates with their anonymous tower blocks and large barren spaces. Word Origin. anonymous definition: 1. made or done by someone whose name is not known or not made public: 2. having no unusual or…. Learn more. Approach an anonymous letter as if writing a normal letter. The only big difference is that you will not include your name or any other personal details. Otherwise, the basic layout and structure of the letter are the same as normal. This means that the content of your anonymous letter is dependent on what you want to write about, to whom and why. If you remain anonymous when you do something, you do not let people know that you were the person who did it. You can remain anonymous if you wish. An anonymous benefactor stepped in to provide the prize money. ...anonymous phone calls. Synonyms: unnamed, unknown, unidentified, nameless More Synonyms of anonymous. Anonymous letters can be hurtful and sometimes damaging. The authors of these letters may feel able to say anything in the content of their letter, which tends to make the authors overconfident as well as highly critical. If you receive an... What does anonymous mean? Having an unknown or unacknowledged name. (adjective) An anonymous author.

what is anonymous letter meaning top

Sincerely Anonymous Letter #3 Husbands Response - YouTube

Definition, examples of use and spelling of the word ANONYMOUS. created for Audio-Visual Lexis https://www.avlexis.com Contents of this video ... Get the VPN that I use (affiliate). https://nordvpn.com/powercertUse coupon code 'powercert' and get 68% off a 2-year plan + 4 months free.A proxy server is... About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features Press Copyright Contact us Creators ... Keep up-to-date with the latest by subscribing. Person Gets An Angry Letter From An Anonymous Neighbor Claiming Her Garage Door Is "Ghetto Graffiti", But The Internet Thinks It's Awesome0:00 - Intro0:00:12... How to pronounce anonymous? This video provides examples of American English pronunciations of anonymous by male and female speakers.In addition, it exp... Reading letter from subscriber's husband who is HIV positive. #HIV #HIVpositiveTo help support my vlogs:Cash App: $RoxRoxG1969#Venmo: Roxanne-Green-12To Find... A new music service with official albums, singles, videos, remixes, live performances and more for Android, iOS and desktop. It's all here. This is the link about tts :https://support.discordapp.com/hc/en-us/articles/212517297-Text-to-Speech-101The Text-to-Speech (TTS) function will help you to m... ANONYMOUS(111)How Remember ANOMALOUS ANOMALOUS in Hindi ANOMALOUS meaning ANOMALOUS का हिंदीDr Imran husain is a renowned Neuropsychiatrist.He has speci...

Anonymous Definition of Anonymous at Dictionary.com

what is anonymous letter meaning

what is anonymous letter meaning - win

TIFU by not signing a birthday card properly

I'll make the quesadillas exactly as ordered, but you pay the dry cleaners